Loading EVA...

sRNA Design

Bacterial RNA

Small regulatory RNA for bacterial gene regulation & synthetic biology circuits.

Generate RNA sequence from scratch

Prompt Sequence (optional)

0 / 10,000A, U, G, C

Species (optional)

Max Length200

Research Highlights

Published examples and benchmark results for sRNA design.

Paper Examples

Synthetic Riboswitch

Engineered sRNA for gene circuit regulation.

AUGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC

Escherichia coliACS Synth. Biol. 2024

Benchmark Results

Dynamic Range

50x

Regulatory Range

Wide dynamic range in gene expression control.

View paper

Crosstalk

<2%

Orthogonality

Minimal crosstalk between orthogonal sRNA regulators.

View paper

Exploring EVA...

Back to Home

sRNA Design

Bacterial RNA

Small regulatory RNA for bacterial gene regulation & synthetic biology circuits.

Generate RNA sequence from scratch

Prompt Sequence (optional)

0 / 10,000A, U, G, C

Species (optional)

Max Length200

Research Highlights

Published examples and benchmark results for sRNA design.

Paper Examples

Synthetic Riboswitch

Engineered sRNA for gene circuit regulation.

AUGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC

Escherichia coliACS Synth. Biol. 2024

Benchmark Results

Dynamic Range

50x

Regulatory Range

Wide dynamic range in gene expression control.

View paper

Crosstalk

<2%

Orthogonality

Minimal crosstalk between orthogonal sRNA regulators.

View paper